| Description | 
                                                                                                                    
                                                            HPLC purified SafeEdit sgRNA with modifications targeting the first exon of the constant chain of the TCRα gene (TRAC), which enhances CAR-T cell potency and persistence by utilizing the endogenous transcriptional control of TCR gene.  For customized sgRNA synthesis service, please visit :https://www.genscript.com/crispr-cas9-single-guide-RNA-and-ribonucleoprotein.html [Reference] Roth. et al. Reprogramming human T cell function and specificity with non-viral genome targeting. Nature 2018, 559(7714): 405-409.  | 
                                                ||||||
| Sequence | 
                                                                                                                    
                                                             mA*mG*mA*GUCUCUCAGCUGGUACAGUUUUAGAGCUAGAAAUAGCAAGUUAAAA                                                                                                             UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*mU*mU m = 2'O-Methyl RNA; * = Phosphorothioate  | 
                                                ||||||
| Storage Condition | Stable for at least 24 months at -20°C. Avoid repeated freeze-thaw cycles. | ||||||
| Quality Specifications | 
                                                                                                                    
  |